4. “SR (coding (sense) sequence below, 5 to 3) is a human male sex development gene that has one exon and encodes a product that is 204 amino acids long It is located on the Y chromosome and the SRY protein is essential for male development. It functions by binding to DNA and activating transcription of male-specific genes. The text bubbles describe three different hypothetical mutations in SRY TCAGGACAGCAGTAGAGCAGTCAGGGAGGC T enhancer AGATCAGCAGGGCAAGTAG’TCAACGTTACT Mutation at GAATTACCATGTT TTGCTTGAGAATGAATA TTTCATTA CATT GTCAGGGTACTAGGGGGTAGGC TGGGCGGGGTTGAGGGGGTG AGAAATGCAAGTTTCATTACAAAAGTTAAC promote GTAACAAAGAATCTGGTAGAAGTGAG TTTT GGATAGTAAAAATAAGTT TCGAAC TCTGGCAA ccTTTCAA TTTTGTCGcACTCTCcTTGTTT exon TTGACAATGCAATCATATGcTTCTGcTATG (845 bp) TTCAACAGCGATGATTACAGT TA cCAGCTGTGCAAGAGAA TATTCCCGCTCTC Mutation b cGGAGAAGcTcTTccTTccTTTGCAce AGCTGTAACTCTAAGTATCAG TGTGAAAC changed to GGAGAAAACA GTAAAGGCAAC GTCCAGGAT AGAGTGAAGCGAC CCA TGAACGCAT TCA GTG TGG TCTCGCGATCAGAGGCGCAAGATG Mutation C: ATACCAGTGG ATC AAAA TGCTTACTGAAGCCGAAAA ATGGCCA changed to TTCTTCCAGGAGGCACAGAAATTACAGGCC ATGCACAGAGAGAAATACCCGAATTATAAG TATCGAccTCGTCGGAAGGCGAAAGATGCTG TTGCAGTTTGcTTCCCGCAGAT CCGALAGAA ccCGCTTCGGTACTCTGCAGCGAAGTGCAA CTGGACAACAGGTTGTACAGGGATGACTGT ACGAAAGCCACACACTCAAGAATGGAGCAC CAGcTAGGCCACT TACCGCCCAT CAACGCA GcCAGCTCACCGCAGCAACGGGAccGCTAC AGccACTGGACAAAGCTGTAGGACAATCGG The two images above show the 3D CTACCTAGAT GTAACATTGGCTACAAAGAC structure of SRY (amino acids 58-130) GcTCCTTTTTACGATAACTTACAGCCCTCA bound to DNA. Hydrophobic amino cTTTCTTATGTTTAGTT TCAATATTGT”TTT cTTTTcTcTGGcTAATAAAGGccTTATTCA acids are grey. lic amino acids are white. Spheres mark the N- and C- TT TCAGTTTTACTGGTATTTCATTTTAAAC TTAATTTCAAGACAAGT TGTGTCAACACGA terminal ends in the stick model. A. (4 pt) In the sequence above circle the start codon and the stop codon B. (4 pt) In the sequence above underline the 3′ untranslated region (a sequence that is part of the mRNA, but is found after the stop codon) and the 5 untranslated region (a sequence that is a part of the mRNA but is before the start codon)