A. Part of a gene is shown below. The sequence of both DNA
strands is shown. The italicized area is the promoter, and the
bases in bold-type indicate the transcriptional start site.
5’GGCTAACTAACGATTCCCCAGGCTACCCAGGCATTATAC3′

3’CCGATTGATTGCTAAGGGGTCCGATGGGTCCGTAATATG5′

Which strand is the template strand? The upper strand or
the lower strand?

B. Part of a gene is shown below. The sequence of both DNA
strands is shown. The italicized area is the promoter, and the
bases in bold-type indicate the transcriptional start site.
5’GGCTAACTAACGATTCCCCAGGCTACCCAGGCATTATAC3′

3’CCGATTGATTGCTAAGGGGTCCGATGGGTCCGTAATATG5′

Write the sequence of the RNA molecule that is
transcribed from the template strand. Indicate the 5′ and 3′ ends
of the strand.

C. The base sequence of a protein-coding gene is shown below.
The lower case letters represent the base sequence of the promoter.
The upper case letters represent the base sequence of the
transcribed region.

5’tgatggccaaggtctggaaaccacctatttataccgcccACGGCTACCAGCG3’

3’actaccggttccagacctttggtggataaatatggcgggTGCCGATGGTCGC5’

What would be the number of the bold base
pair?