Question 3

B1020600 HW #5 Oct. 12/13 Due This sequence is to be used for both questions. This micro sequence and the size of the introns are NOT indicative of real genes, which are much longer in length; this sequence was designed solely for educational purposes. Shine Delgarno sequence is AGGAGG, Kozak sequence is ACCAUGG, stop codons are UAA, UAG, and UGA. GGGATTGGGACCATGGTTGGGATTGGGAGTAGTCTAGC GTACCGGCATTGAACGGAGGACCTCCTTGAGATTA-5 CCCTAACCCTGGTACCAACCCTAACCCTCATCAGATCG CATGGCCGTAACTTGCCTCCTGGAGGAACTCTAAT l) Suppose that the sequence is for a prokaryotic chromosome. a) Given the sequence, which strand is most likely to be the template strand and which the RNA-like strand (top strand or bottom strand)? Indicate with an arrow where the promoter would be b) What is the translational product? How many amino acids are there? c) Where would the TATA box be located (although not necessarily on this sequence)? Indicate with an arrow ONLY 2 Suppose that the sequence is for a eukaryotic chromosome. a) Given the sequence, which strand is most likely to be the template strand and which the RNA-like strand (top strand or bottom strand)? Indicate with an arrow where the promoter would be. 3) Given that there is wobble in the third position of codons, what is the minimum number of distinct tRNA molecules that a cell needs? Hint: Look at the genetic code table. 4) (modified from exam 1) I. Redrawing the diagram below, indicate a DSB and ONE tail invasion. I. For that tail, indicate CLEARLY to what strand that tail is hybridizing and the direction of DNA synthesis.