Number 4 is completely answered. I only included it to give you
background information about question #5. Please only answer #5.
There is enough information given.

4. “SRY (coding (sense) sequence below, 5 to 3 )is a human male sex development gene that has one exon and encodes a product that is 204 amino acids long. It is located on the Y chromosome and the SRY protein is essential for male development. It functions by binding to DNA and activating transcription of male-specific genes The text bubbles describe three different hypothetical mutations in SRY ATCAGCAGGGCAAGTAG TCAACGTT GAATTACCATGT TTTGCTTGAGAATGAATA. CATTGTCAGGGTACTAGGGGGT changed to MGA AATGCAAGT TTCATTAC GGATAGTAAAATAA GTTTCGA ACTCTGGCA exon ATG (845 bp) AATCATA TGATTACNGT TA TTOcCGCTCTC Mutation b TAA CTCTAAGTATCAGTGTGAAACG TAAAGGCAACGTcCAGGAT NGAGSTGAAGCGACCCATGAACGCATTCAS TG TGGTCTCGCGATCAGAGGCGCANGATG CA Mutation AGATcAGCAAoCAGCTGGGATACCAGTOG AAAATGcTTACTGANGCOGAAAAATGGCCA changed to TICITOCAGGAGGCACAGAAATTACAGGcc ATOCNCAGAGAGAANTAcceGMTTATANG TTTGCTTOccoCAGAT cGCTTCGGTACTCT GCAGCGAAGTGCAA CAGOTAGGCCACTTACCGCCO ATCAACGC The two images above show the 3D TANCATTOGCTACAMAGACCTACCTAGAT structure of SRY (amino acids 58- 130) ACGATA ACT TACAGCccTCA bound to DNA. Hydrophobic amino TA acids are grey. Hydrophilic amino acids are white. Spheres mark the N- and ITTAATTICAMGACAAGTTGTGTCAACACGA terminal ends in the stick model. A (4 pt)1n the sequence above circle the start codon and the stop codon B (4 p) In the sequence above underlins the 3 untranslated region a sequence that is part of the mRNA, but is found after the stop codon) and the 5′ untranslated region (a sequence that is a part of the mRNA but is before the start codon) C. 15 pt) Predict the outcome of each hypothetical mutation (mutations a, band c) In your answers, name the specific type of mutation Cpoint mutation” istoo broad) and