Please help me with this one! I would be beyond grateful and
willing to highly recommend/ help you in any way.

4. “SRY (coding (sense) sequence below, 5′ to 3′) is a human male sex development gene that has one exon and encodes a product that is 204 amino acids long. It is located on the Y chromosome and the SRY protein is essential for male development. It functions by binding to DNA and activating transcription of male-specific genes. The text bubbles describe three different hypothetical mutations in SRY TCAGGACAGCAGTAGAGCAGTCAGGGAGGc enhancer AGCAGGGCAAGTAGTCAACGTTACT Mutation a GAATTACCAT GTTTTGCTTGAGAATGAATA ETCATAC CATT GTCAGGGTACTAGGGGGTAG GCTGGT changed to TGGGCGGGGTTGAGGGGG AGAAATGCAAGTTTCATTACAAAAAGTTA AC Bromoter ccTTTCA ATTTTGTCGCAC TCTcCTTGTTT exon TTGACAATGCAATCATA (845 bp) TGATTACAGT TATTC CCGCTCTC AGcTGTAACTCTAAGTATCAGTGTGAAACG GGAGAAAACAGTAAAGGCAACGTCCAGGAT AGAGTGAAGCGAcoCATGAACGCATTCA GTG TGGTCTCGCGATCAGAGGCGCAAGATG Mutation TACCAGTGG ATC AAA ATGCTTACTGAAGccGAAAAA TGGCC TTCTTCCAGGAGGCACAGAAATTACAGGcc ATGCACAGAGAGAAA TACCCGAATTATAAG ATCGAccTCGTCGGAAGGCGAAGA TGCTG CCGAAAGAATTGCAGTTTGcTTCCCGCAGAT cGCTTCGGTAC TCTGCAGCGAAGTGc. CTG GACAACAGGTTGTACAGGGATGACTGT ACGA.AAGCCACACACTCAAGAATGGAGCAC CAGC TAGGCOAC TTACCGCCCATCAACGCA GcCAGCTCACCGCAGCAACGGGAccGCTAC CACTGGACAAAG CTGTAGGACAATCGG The two images above show the 3D GTAACA TTG GCTACAAAGAccTACCTAGAT structure of SRY (amino acids 58-130) GCT CCTTTTTAC GATAACTTACAGCCCTCA TTATGTTTAGTTTCAA bound to DNA. Hydrophobic amino TATTG TTTT TGGCTAATAA AGGCCTTATTCA acids are grey. Hydrophilic amino acids TTTCAGTTTTACTGGTA’ TTTCATTTTAAAC are white, Spheres mark the N- and C- TTAATTTCAAGACAAGTTGTGTCAACACGA terminal ends in the stick model. A. (4 pt)In the sequence above circle the start codon and the stop codon B. (4 pt) In the sequence above underline the 3 untranslated region (a sequence that is part of the mRNA, but is found after the stop codon) and the 5 untranslated region (a sequence that is a part of mRNA but is before the start codon) C. (15 p) Predict the outcome of each hypothetical mutation (mutations a, c) In band your answers, name the specific type of mutation (point mutation” is too broad) and